Stem-loop sequence cbr-mir-355

AccessionMI0001422 (change log)
DescriptionCaenorhabditis briggsae miR-355 stem-loop
Gene family MIPF0000236; mir-355
Stem-loop
   cuacugauu   a         aa    a    u         cu -       ----   u 
5'          aug uuagucagc  ucgg uggu uguuuuagc  g agcuaug    ugu a
            ||| |||||||||  |||| |||| |||||||||  | |||||||    |||  
3'          uac agucaguug  agcu acca acaaaaucg  c ucgauac    acg u
   ---------   -         --    a    u         uu a       uuau   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrII: 7347335-7347443 [-]
intergenic
Database links

Mature sequence cbr-miR-355

Accession MIMAT0001319
Sequence

33 - 

uuuguuuuagccugagcuaug

 - 53

Get sequence
Evidence by similarity; MI0000754

References

1