Stem-loop sequence rno-mir-421

AccessionMI0001423 (change log)
DescriptionRattus norvegicus miR-421 stem-loop
Gene family MIPF0000098; mir-95
Literature search

6 open access papers mention rno-mir-421
(17 sentences)

Stem-loop
       cu      -    uua            a   aaa 
5' caca  guaggc cuca   aauguuuguuga uga   a
   ||||  |||||| ||||   |||||||||||| |||   a
3' gugu  cguccg gggu   uuacagacaacu acu   u
       cu      c    uaa            -   aag 
Get sequence
Deep sequencing
125540 reads, 6.88 reads per million, 494 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 74443492-74443570 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-421
rno-mir-374chrX: 74443648-74443715 [-]
rno-mir-421chrX: 74443492-74443570 [-]
Database links

Mature sequence rno-miR-421-5p

Accession MIMAT0001320
Previous IDsrno-miR-421
Sequence

10 - 

ggccucauuaaauguuuguug

 - 30

Get sequence
Deep sequencing527 reads, 186 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-421-3p

Accession MIMAT0017175
Previous IDsrno-miR-421*
Sequence

47 - 

aucaacagacauuaauuggg

 - 66

Get sequence
Deep sequencing124995 reads, 494 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).