Stem-loop sequence ath-MIR417

Accession MI0001428
Description Arabidopsis thaliana miR417 stem-loop
Stem-loop 
        u   -aa  -gg  aa    -cg      uuu           uc  cuu   ga 
aaauauau caa   gu   uc  aaca   ucacua   ccuuuauguuu  cc   auu  u
|||||||| |||   ||   ||  ||||   ||||||   |||||||||||  ||   |||   
uuuauaua guu   ua   ag  uugu   agugau   ggaaguacaaa  gg   uaa  g
        -   gua  aua  -c    uua      ---           uu  ---   ag
Get sequence
Deep sequencing
1 reads, 1 experiments
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr2: 13708748-13708864 [-]
intergenic

Mature sequence ath-miR417

Accession MIMAT0001325
Sequence

78 -  

gaagguagugaauuuguucga

 - 98

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).