miRBase entry: hsa-mir-424

Stem-loop hsa-mir-424


Accession
MI0001446
Symbol
HGNC: MIR424
Description
Homo sapiens hsa-mir-424 precursor miRNA mir-322
Gene
family?
RF00737; mir-322

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR424, which is the ortholog of rat miR322, is a microRNA involved in the regulation of various cellular processes [PMC7123062]. In the context of tumor growth, a significant reduction in MIR424 expression has been observed in tumors that exceed 5 cm in diameter [PMC8007794]. This decrease in MIR424 levels appears to be temporally associated with the induction of vascular smooth muscle cell (vSMC) proliferation, as its concentration initially drops following this cellular event but subsequently increases [PMC7123062]. The dynamic expression pattern of MIR424 suggests a potential role in tumor progression and cellular proliferation processes [PMC8007794; PMC7123062]..

Literature search
166 open access papers mention hsa-mir-424
(848 sentences)

Sequence

735507 reads, 3500 reads per million, 122 experiments
cgaggggauaCAGCAGCAAUUCAUGUUUUGAAguguucuaaaugguuCAAAACGUGAGGCGCUGCUAUacccccucguggggaagguagaaggugggg
(((((((.((.((((((..(((((((((((((.((((...)))).)))))))))))))..)))))).)).))))))).....................

Structure
---------------------       a  C      AA             g    c 
                     cgagggg ua AGCAGC  UUCAUGUUUUGAA uguu  
                     ||||||| || ||||||  ||||||||||||| |||| u
                     gcucccc aU UCGUCG  GAGUGCAAAACuu guaa  
gggguggaagauggaaggggu       c  A      CG             g    a 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells [1]. The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.

Genome context
chrX: 134546614-134546711 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-424
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-424 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-424-5p

Accession MIMAT0001341
Description Homo sapiens hsa-miR-424-5p mature miRNA
Sequence 11 - CAGCAGCAAUUCAUGUUUUGAA - 32
Evidence experimental
cloned [1-2], Northern [1]
Database links
Predicted targets

Mature hsa-miR-424-3p

Accession MIMAT0004749
Description Homo sapiens hsa-miR-424-3p mature miRNA
Sequence 48 - CAAAACGUGAGGCGCUGCUAU - 68
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043