miRBase entry: mmu-mir-425

Stem-loop mmu-mir-425


Accession
MI0001447
Symbol
MGI: Mir425
Description
Mus musculus mmu-mir-425 precursor miRNA
Gene family
MIPF0000242; mir-425

Literature search
19 open access papers mention mmu-mir-425
(82 sentences)

Sequence

102140 reads, 668 reads per million, 104 experiments
aaagugcuuuggAAUGACACGAUCACUCCCGUUGAgugggcacccaagaagccAUCGGGAAUGUCGUGUCCGCCcagugcucuuu
((((.((.((((...(((((((.((.(((((....((((............))))))))).)))))))))...)))).)).))))

Structure
    u  u    AAU       U  C     UUGA    gcacc 
aaag gc uugg   GACACGA CA UCCCG    gugg     c
|||| || ||||   ||||||| || |||||    ||||      
uuuc cg gacC   CUGUGCU GU AGGGC    UAcc     a
    u  u    CGC       -  A     ----    gaaga 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 108568777-108568861 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-425
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-425-5p

Accession MIMAT0004750
Description Mus musculus mmu-miR-425-5p mature miRNA
Sequence 13 - AAUGACACGAUCACUCCCGUUGA - 35
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-425-3p

Accession MIMAT0001342
Description Mus musculus mmu-miR-425-3p mature miRNA
Sequence 54 - AUCGGGAAUGUCGUGUCCGCC - 74
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009