Stem-loop sequence xla-mir-427

AccessionMI0001449 (change log)
DescriptionXenopus laevis miR-427 stem-loop
Gene family MIPF0000441; mir-427
Literature search

3 open access papers mention xla-mir-427
(28 sentences)

Stem-loop
      a  c       --   u  c   ug g cug 
5' agc cc aaaacgg  ggc cu ucu  u a   a
   ||| || |||||||  ||| || |||  | |    
3' uug gg uuuuguc  ucg ga aga  a u   a
      c  u       uu   u  a   gu g auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
Sc000045_chrNA: 158-225 [+]
intergenic
Database links

Mature sequence xla-miR-427

Accession MIMAT0001344
Sequence

45 - 

aaagugcuuucuguuuuuggcg

 - 66

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).