Stem-loop sequence xla-mir-428

AccessionMI0001450
DescriptionXenopus laevis miR-428 stem-loop
Gene family MIPF0000320; mir-428
Stem-loop
      --gu     u    --     c  gu     ug 
5' cac    cggcc aacu  ggagc cu  cucau  c
   |||    ||||| ||||  ||||| ||  |||||  a
3' gug    guugg uuga  ucucg ga  gagug  g
      aguc     c    uc     u  au     uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-428

Accession MIMAT0001345
Sequence

43 - 

uaagugcucucuaguucgguug

 - 64

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).