Stem-loop sequence xla-mir-428

AccessionMI0001450 (change log)
DescriptionXenopus laevis miR-428 stem-loop
Gene family MIPF0000320; mir-428
Stem-loop
   --    uu    a      - -     gu   -  ug 
5'   caca  ggcc aacugg g gcgcu  cuc cu  u
     ||||  |||| |||||| | |||||  ||| ||   
3'   gugu  uugg uugauc c cguga  gag ga  a
   gu    cg    c      u u     au   u  cu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 528888-528958 [+]
intergenic
Clustered miRNAs
< 10kb from xla-mir-428
xla-mir-428chr8L: 528888-528958 [+]
xla-mir-428bchr8L: 529335-529392 [+]
Database links

Mature sequence xla-miR-428

Accession MIMAT0001345
Sequence

43 - 

uaagugcucucuaguucgguug

 - 64

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).