Stem-loop sequence xla-mir-429

AccessionMI0001451 (change log)
DescriptionXenopus laevis miR-429 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -au  c          ag       cu  u 
5'    gu uuaccagaca  guuagau  ag u
      || ||||||||||  |||||||  || a
3'    cg aauggucugu  uaaucug  uc c
   ugc  u          ca       -c  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr7L: 78948298-78948358 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-429
xla-mir-200bchr7L: 78952754-78952813 [-]
xla-mir-200a-2chr7L: 78951028-78951089 [-]
xla-mir-429chr7L: 78948298-78948358 [-]
Database links

Mature sequence xla-miR-429

Accession MIMAT0001346
Sequence

40 - 

uaauacugucugguaaugccg

 - 60

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).