Stem-loop sequence xla-mir-19b

AccessionMI0001452 (change log)
DescriptionXenopus laevis miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

2 open access papers mention xla-mir-19b
(6 sentences)

Stem-loop
     uc u        a  -   -      u    ug  u 
5' gc  c gucaguuu gc ugg uuugca cagc  gc a
   ||  | |||||||| || ||| |||||| ||||  ||  
3' cg  g cagucaaa cg acc aaacgu gucg  ug c
     gu u        a  u   u      -    --  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 48821956-48822028 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-19b
xla-mir-106chr8L: 48822350-48822405 [-]
xla-mir-18a-1chr8L: 48822216-48822294 [-]
xla-mir-20chr8L: 48822066-48822139 [-]
xla-mir-19bchr8L: 48821956-48822028 [-]
xla-mir-92a-2chr8L: 48821825-48821900 [-]
xla-mir-363chr8L: 48821690-48821777 [-]
Database links

Mature sequence xla-miR-19b

Accession MIMAT0001347
Sequence

44 - 

ugugcaaauccaugcaaaacuga

 - 66

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).