Stem-loop sequence xla-mir-19b

AccessionMI0001452
DescriptionXenopus laevis miR-19b stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     uc u        a  -   -      u    ug  u 
5' gc  c gucaguuu gc ugg uuugca cagc  gc a
   ||  | |||||||| || ||| |||||| ||||  ||  
3' cg  g cagucaaa cg acc aaacgu gucg  ug c
     gu u        a  u   u      -    --  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-19b

Accession MIMAT0001347
Sequence

44 - 

ugugcaaauccaugcaaaacuga

 - 66

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).