Stem-loop sequence xla-mir-20

AccessionMI0001453 (change log)
DescriptionXenopus laevis miR-20 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention xla-mir-20
(1 sentences)

Stem-loop
   -     -ucca           g     g   ---u  u 
5'  gcagu     aagugcucaua ugcag uag    ug a
    |||||     ||||||||||| ||||| |||    ||  
3'  cguca     uucacggguau auguc auc    ac u
   u     ugaca           a     -   uugu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 48822066-48822139 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-20
xla-mir-106chr8L: 48822350-48822405 [-]
xla-mir-18a-1chr8L: 48822216-48822294 [-]
xla-mir-20chr8L: 48822066-48822139 [-]
xla-mir-19bchr8L: 48821956-48822028 [-]
xla-mir-92a-2chr8L: 48821825-48821900 [-]
xla-mir-363chr8L: 48821690-48821777 [-]
Database links

Mature sequence xla-miR-20

Accession MIMAT0001348
Sequence

8 - 

caaagugcucauagugcagguag

 - 30

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).