Stem-loop sequence xla-mir-18a-1

AccessionMI0001454 (change log)
DescriptionXenopus laevis miR-18a-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention xla-mir-18a-1
(4 sentences)

Stem-loop
             --   u    c   u     ua   a aua 
5' ccuuguguua  agg gcau uag gcagu  gug c   g
   ||||||||||  ||| |||| ||| |||||  ||| |    
3' gggacacggu  ucc cgua auc cguca  uac g   c
             uu   u    a   c     uc   - aug 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 48822216-48822294 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-18a-1
xla-mir-106chr8L: 48822350-48822405 [-]
xla-mir-18a-1chr8L: 48822216-48822294 [-]
xla-mir-20chr8L: 48822066-48822139 [-]
xla-mir-19bchr8L: 48821956-48822028 [-]
xla-mir-92a-2chr8L: 48821825-48821900 [-]
xla-mir-363chr8L: 48821690-48821777 [-]
Database links

Mature sequence xla-miR-18a-5p

Accession MIMAT0001349
Sequence

9 - 

uaaggugcaucuagugcaguuag

 - 31

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).