Stem-loop sequence xla-mir-133a

AccessionMI0001455 (change log)
DescriptionXenopus laevis miR-133a stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention xla-mir-133a
(5 sentences)

Stem-loop
         uu g   a       aa  u  a        accuc 
5' cagugc  u cua agcuggu  aa gg accaaauc     u
   ||||||  | ||| |||||||  || || ||||||||      
3' guuacg  a gau ucgacca  uu cc ugguuuag     u
         uu g   g       ac  c  c        guaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr6S: 78981006-78981091 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-133a
xla-mir-1achr6S: 78983408-78983468 [-]
xla-mir-133achr6S: 78981006-78981091 [-]
Database links

Mature sequence xla-miR-133a

Accession MIMAT0001350
Sequence

53 - 

uugguccccuucaaccagcugu

 - 74

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).