Stem-loop sequence sbi-MIR166d

AccessionMI0001497 (change log)
DescriptionSorghum bicolor miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166d
(11 sentences)

Stem-loop
           uu      cu      g   g    ug -     u 
5' ggggaaug  gucugg  cgaggu cag aaca  c agauc c
   ||||||||  ||||||  |||||| ||| ||||  | ||||| a
3' ccccuuac  cggacc  gcucua guu uugu  g ucugg u
           uu      ag      -   g    ua a     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 63914216-63914302 [-]
intergenic
Database links

Mature sequence sbi-miR166d

Accession MIMAT0001391
Sequence

67 - 

ucggaccaggcuucauuccc

 - 86

Get sequence
Evidence by similarity; MI0000206

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).