Stem-loop sequence sbi-MIR166c

AccessionMI0001498 (change log)
DescriptionSorghum bicolor miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166c
(13 sentences)

Stem-loop
           uu        g      uaa      gaau   c    ga 
5' ggggaaug  gucugguc gagacc   caccgc    cau caug  g
   ||||||||  |||||||| ||||||   ||||||    ||| ||||   
3' ccccuuac  cggaccag cuuugg   guggug    gua guac  c
           uu        g      uag      ----   c    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 76349131-76349224 [-]
intergenic
Database links

Mature sequence sbi-miR166c

Accession MIMAT0001392
Sequence

74 - 

ucggaccaggcuucauuccc

 - 93

Get sequence
Evidence by similarity; MI0000206

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).