Stem-loop sequence sbi-MIR166a

AccessionMI0001500 (change log)
DescriptionSorghum bicolor miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166a
(11 sentences)

Stem-loop
   gu      uu         a        cuugu          -   uuug   a 
5'   ggaaug  gucugguuc aggucucg     gauuuaagga uga    ugc u
     ||||||  ||||||||| ||||||||     |||||||||| |||    |||  
3'   ccuuac  cggaccagg ucuagagu     cuaaguuccu auu    aug g
   cc      uu         c        ---au          u   uuua   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 17260549-17260656 [-]
intergenic
Database links

Mature sequence sbi-miR166a

Accession MIMAT0001394
Sequence

88 - 

ucggaccaggcuucauuccc

 - 107

Get sequence
Evidence by similarity; MI0000202

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).
3
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).