Stem-loop sequence dre-mir-430a-1

AccessionMI0001527
Previous IDsdre-mir-430a
DescriptionDanio rerio miR-430a-1 stem-loop
Gene family MIPF0000003; mir-430
Stem-loop
         -auc g      c     -      g   ugg     
5' gucacu    g ugcccu acaaa ggcacu acu   augc 
   ||||||    | |||||| ||||| |||||| |||   ||| u
3' caguga    u augggg uguuu ucguga ugg   uacg 
         acuu g      u     a      a   -ug     
Get sequence
Deep sequencing
37522 reads, 2.24e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 4333896-4333977 [-]
sense
ENSDART00000117940 ; dre-mir-430a-1.1-201; exon 1
Database links

Mature sequence dre-miR-430a-3p

Accession MIMAT0001423
Previous IDsdre-miR-430a
Sequence

50 - 

uaagugcuauuuguugggguag

 - 71

Get sequence
Deep sequencing1361706 reads, 4 experiments
Evidence experimental; cloned [1-2]
Validated targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).