Stem-loop sequence sbi-MIR166e

AccessionMI0001550 (change log)
DescriptionSorghum bicolor miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166e
(11 sentences)

Stem-loop
   -caa  u  ag     g    u       uu         a      -c  -   c   -ca        u    uu 
5'     gu ga  guuag uuaa gggguug  gucugguuc aggucg  ca cag aga   aagcccau uugc  a
       || ||  ||||| |||| |||||||  ||||||||| ||||||  || ||| |||   |||||||| ||||  g
3'     cg cu  cgauc aauu cccuaac  cggaccagg ucuagc  gu guu ucu   uuugggua gacg  c
   uaua  u  -a     -    u       uu         c      ua  a   a   cua        c    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 61405284-61405434 [+]
intergenic
Database links

Mature sequence sbi-miR166e

Accession MIMAT0001446
Previous IDssbi-MIR166e
Sequence

112 - 

ucggaccaggcuucaaucccu

 - 132

Get sequence
Evidence by similarity; MI0001108

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).