Stem-loop sequence sbi-MIR166f

AccessionMI0001569 (change log)
DescriptionSorghum bicolor miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166f
(13 sentences)

Stem-loop
   ccuuggu      ------               uu g    cu   g  a  -  ---cg   --    uu     u 
5'        cauggg      gguuuguggggaaug  g cugg  cga gc uc cg     ucc  uggc  gcaga c
          ||||||      |||||||||||||||  | ||||  ||| || || ||     |||  ||||  |||||  
3'        guaccu      ccaaacgcuccuuac  c gacc  gcu cg ag gc     agg  aucg  cguuu g
   -------      acgugg               uu g    ag   g  g  a  uagaa   cc    uc     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 64857783-64857921 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR166f
sbi-MIR166fchr4: 64857783-64857921 [-]
sbi-MIR166gchr4: 64857514-64857647 [-]
Database links

Mature sequence sbi-miR166f

Accession MIMAT0001465
Previous IDssbi-MIR166f
Sequence

100 - 

ucggaccaggcuucauuccuc

 - 120

Get sequence
Evidence by similarity; MI0001143

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).