Stem-loop sequence aga-let-7

AccessionMI0001600 (change log)
DescriptionAnopheles gambiae let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention aga-let-7
(10 sentences)

Stem-loop
     -      c  u u    g    u           acc   gu 
5' gc cuacuc cg g ugag uagu gguuguauagu   gug  u
   || |||||| || | |||| |||| |||||||||||   |||  c
3' ug gauggg gc c auuc aucg cuaacauauca   cau  c
     a      u  u c    a    c           gcu   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 10270708-10270797 [-]
intergenic
Clustered miRNAs
< 10kb from aga-let-7
aga-mir-100chr3R: 10274677-10274768 [-]
aga-let-7chr3R: 10270708-10270797 [-]
aga-mir-125chr3R: 10270160-10270271 [-]
Database links

Mature sequence aga-let-7

Accession MIMAT0001495
Sequence

15 - 

ugagguaguugguuguauagu

 - 35

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).