Stem-loop sequence aga-mir-10

AccessionMI0001602 (change log)
DescriptionAnopheles gambiae miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention aga-mir-10
(9 sentences)

Stem-loop
     cg  uu           cc   -  g    u           -ug   u 
5' gu  au  auguucuacau  acc cu uaga ccgaauuuguu   aau u
   ||  ||  |||||||||||  ||| || |||| |||||||||||   |||  
3' ca  ug  uacggggugug  ugg ga aucu ggcuuaaacaa   uua a
     au  uu           uu   a  g    u           uaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 59711765-59711866 [-]
intergenic
Database links

Mature sequence aga-miR-10

Accession MIMAT0001497
Sequence

22 - 

acccuguagauccgaauuugu

 - 42

Get sequence
Evidence by similarity; MI0000130