Stem-loop sequence aga-mir-125

AccessionMI0001605 (change log)
DescriptionAnopheles gambiae miR-125 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention aga-mir-125
(1 sentences)

Stem-loop
          u      uuuguau        uc  u    c cu         cuau guu 
5' uauuguu cguuuu       cugcugau  cc gaga c  aacuuguga    c   g
   ||||||| ||||||       ||||||||  || |||| |  |||||||||    |    
3' auggcaa guagag       ggcgauua  gg cucu g  uugaacacu    g   c
          c      -----uu        -u  c    a uu         --uu aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 10270160-10270271 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-125
aga-mir-100chr3R: 10274677-10274768 [-]
aga-let-7chr3R: 10270708-10270797 [-]
aga-mir-125chr3R: 10270160-10270271 [-]
Database links

Mature sequence aga-miR-125

Accession MIMAT0001500
Sequence

30 - 

ucccugagacccuaacuuguga

 - 51

Get sequence
Evidence by similarity; MI0000417