Stem-loop sequence aga-mir-133

AccessionMI0001606 (change log)
DescriptionAnopheles gambiae miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention aga-mir-133
(2 sentences)

Stem-loop
   --          cauc  gu    -----     --------       u 
5'   agcugguuga    gg  caaa     ucgua        auauugu g
     ||||||||||    ||  ||||     |||||        |||||||  
3'   ucgaccaacu    cc  guuu     agcgu        uauaacg a
   ug          -ucc  ug    acgua     uucccuuu       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 15075209-15075294 [-]
intergenic
Database links

Mature sequence aga-miR-133

Accession MIMAT0001501
Sequence

65 - 

uugguccccuucaaccagcugu

 - 86

Get sequence
Evidence by similarity; MI0000362