Stem-loop sequence aga-mir-13b

AccessionMI0001607 (change log)
DescriptionAnopheles gambiae miR-13b stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention aga-mir-13b
(2 sentences)

Stem-loop
   u    ----         -    a            cc    c     a 
5'  gcuc    guggucagg ucgu aaaaugguugug  gugu gauuu a
    ||||    ||||||||| |||| ||||||||||||  |||| ||||| g
3'  cgag    caccaguuu agca uuuuaccgacac  uaua uugaa a
   a    uucu         g    g            --    c     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 37757564-37757657 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-13b
aga-mir-2-2chr2L: 37758699-37758796 [-]
aga-mir-2cchr2L: 37758085-37758193 [-]
aga-mir-13bchr2L: 37757564-37757657 [-]
aga-mir-2bchr2L: 37757412-37757490 [-]
aga-mir-2-1chr2L: 37757103-37757189 [-]
Database links

Mature sequence aga-miR-13b

Accession MIMAT0001502
Sequence

56 - 

uaucacagccauuuugacgagu

 - 77

Get sequence
Evidence by similarity; MI0000134