Stem-loop sequence aga-mir-14

AccessionMI0001608 (change log)
DescriptionAnopheles gambiae miR-14 stem-loop
Gene family MIPF0000182; mir-14
Literature search

2 open access papers mention aga-mir-14
(22 sentences)

Stem-loop
     -   a  -a   u       c    uu      u    -   auc 
5' gc ccg ua  gcc gugggag gaga  aaggcu gcug guu   a
   || ||| ||  ||| ||||||| ||||  |||||| |||| |||   c
3' cg ggc au  ugg uauccuc cucu  uucuga ugau caa   g
     u   a  ca   c       u    uu      c    g   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 24898041-24898134 [+]
intergenic
Database links

Mature sequence aga-miR-14

Accession MIMAT0001503
Sequence

58 - 

ucagucuuuuucucucuccua

 - 78

Get sequence
Evidence by similarity; MI0000136