Stem-loop sequence aga-mir-210

AccessionMI0001610 (change log)
DescriptionAnopheles gambiae miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

3 open access papers mention aga-mir-210
(21 sentences)

Stem-loop
            ugc     c  ac   -         uua a 
5' gaaauucau   agcug ug  cac ugcacaaga   g a
   |||||||||   ||||| ||  ||| |||||||||   |  
3' uuuugggua   ucggc ac  gug gcguguucu   c u
            uua     a  -a   u         cag g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chrX: 21450335-21450414 [+]
intergenic
Database links

Mature sequence aga-miR-210

Accession MIMAT0001505
Sequence

49 - 

uugugcgugugacaacggcua

 - 69

Get sequence
Evidence by similarity; MI0000376