Stem-loop sequence aga-mir-219

AccessionMI0001611 (change log)
DescriptionAnopheles gambiae miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

2 open access papers mention aga-mir-219
(3 sentences)

Stem-loop
   u    -    c  au      aa           uccu  -      
5'  uucu agcu ug  ugucca  cgcaauucuug    gu gcugg 
    |||| |||| ||  ||||||  |||||||||||    || |||| u
3'  aagg ucgg gc  acaggu  guguugagaac    ca cgauu 
   -    c    u  cu      ca           ---u  u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 21839672-21839758 [-]
intergenic
Database links

Mature sequence aga-miR-219

Accession MIMAT0001506
Sequence

11 - 

ugauuguccaaacgcaauucuug

 - 33

Get sequence
Evidence by similarity; MI0000358