Stem-loop sequence aga-mir-263a

AccessionMI0001612 (change log)
Previous IDsaga-mir-263
DescriptionAnopheles gambiae miR-263 stem-loop
Gene family MIPF0000122; mir-263
Literature search

3 open access papers mention aga-mir-263a
(12 sentences)

Stem-loop
        g   -au   a  g     ga    uu       uuuuu 
5' cccug uac   gua ug cacug  agaa  cacggga     u
   ||||| |||   ||| || |||||  ||||  |||||||     u
3' gggac aug   cau ac gugau  ucuu  gugcccu     c
        -   auc   -  g     uc    --       uacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 12395476-12395561 [+]
intergenic
Database links

Mature sequence aga-miR-263a

Accession MIMAT0001507
Previous IDsaga-miR-263
Sequence

11 - 

uguaauggcacuggaagaauucac

 - 34

Get sequence
Evidence by similarity; MI0000343