Stem-loop sequence aga-mir-275

AccessionMI0001613 (change log)
DescriptionAnopheles gambiae miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

2 open access papers mention aga-mir-275
(4 sentences)

Stem-loop
   u      ucu      a       -ag    a   gg    --    aca 
5'  gagccg   aaugac cgcgcua   cagg acc  gacu  uggu   c
    ||||||   |||||| |||||||   |||| |||  ||||  ||||    
3'  cucggc   uuauug gcgcgau   gucc ugg  cuga  aucg   a
   a      ---      c       gaa    a   -a    cg    cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 38377342-38377436 [+]
intergenic
Clustered miRNAs
< 10kb from aga-mir-275
aga-mir-275chr3R: 38377342-38377436 [+]
aga-mir-305chr3R: 38386246-38386335 [+]
Database links

Mature sequence aga-miR-275

Accession MIMAT0001508
Sequence

61 - 

ucagguaccugaaguagcgcgcg

 - 83

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).