Stem-loop sequence aga-mir-276

AccessionMI0001614 (change log)
DescriptionAnopheles gambiae miR-276 stem-loop
Gene family MIPF0000124; mir-276
Literature search

2 open access papers mention aga-mir-276
(5 sentences)

Stem-loop
   -------   gacug   uc    a     ag           -uaa  g 
5'        ggu     cca  agcg gguau  aguuccuacgg    uc a
          |||     |||  |||| |||||  |||||||||||    ||  
3'        ccg     ggu  ucgu ccaua  ucaaggauguu    ag u
   ccauuug   --aua   uc    g     cu           ucaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR-276-5p and miR-276-3p were cloned in Anopheles stephensi and mappedt to the A. gambiae genome [1].

Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 18991754-18991845 [+]
intergenic
Database links

Mature sequence aga-miR-276-5p

Accession MIMAT0001509
Previous IDsaga-miR-276
Sequence

14 - 

agcgagguauagaguuccua

 - 33

Get sequence
Evidence by similarity; MI0000359

Mature sequence aga-miR-276-3p

Accession MIMAT0006782
Sequence

55 - 

uaggaacuucauaccgugcucu

 - 76

Get sequence
Evidence by similarity; MI0000359

References

1