Stem-loop sequence aga-mir-278

AccessionMI0001616 (change log)
DescriptionAnopheles gambiae miR-278 stem-loop
Gene family MIPF0000155; mir-278
Literature search

3 open access papers mention aga-mir-278
(5 sentences)

Stem-loop
      acgg             u     u  a     guuc   u 
5' ggu    uacggacggacga agucu ca cgacc    cgu u
   |||    ||||||||||||| ||||| || |||||    ||| g
3' ccg    auguuugccugcu ucagg gu gcugg    gca a
      --ga             u     -  g     ---a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3L: 34112621-34112703 [-]
intergenic
Database links

Mature sequence aga-miR-278

Accession MIMAT0001511
Sequence

54 - 

ucggugggacuuucguccguuu

 - 75

Get sequence
Evidence by similarity; MI0000361