Stem-loop sequence aga-mir-279

AccessionMI0001617 (change log)
DescriptionAnopheles gambiae miR-279 stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention aga-mir-279
(2 sentences)

Stem-loop
   u   uau   ug a          a      ugauu     --   a 
5'  ucc   cag  u aaugggugug aucuag     ucaca  uga u
    |||   |||  | |||||||||| ||||||     |||||  |||  
3'  agg   guu  a uuacucacac uagauc     agugu  gcu u
   a   uuu   gu a          c      -----     ua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 55573327-55573415 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-279
aga-mir-279chr2R: 55573327-55573415 [-]
aga-mir-996chr2R: 55572842-55572910 [-]
Database links

Mature sequence aga-miR-279

Accession MIMAT0001512
Sequence

56 - 

ugacuagauccacacucauuaa

 - 77

Get sequence
Evidence by similarity; MI0000363