Stem-loop sequence aga-mir-283

AccessionMI0001620 (change log)
DescriptionAnopheles gambiae miR-283 stem-loop
Gene family MIPF0000054; mir-216
Literature search

3 open access papers mention aga-mir-283
(8 sentences)

Stem-loop
   u     c       aa           u     ua  cuau  auc 
5'  ucgac gaaaggu  auaucagcugg aauuc  gg    ca   c
    ||||| |||||||  ||||||||||| |||||  ||    ||    
3'  agcug cuuuuca  uauagucgacu uuagg  cc    gu   a
   g     c       cc           -     gc  -uac  gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 37890034-37890125 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-283
aga-mir-283chr2R: 37890034-37890125 [-]
aga-mir-1889chr2R: 37888789-37888919 [-]
aga-mir-12chr2R: 37888037-37888153 [-]
Database links

Mature sequence aga-miR-283

Accession MIMAT0001515
Sequence

14 - 

uaaauaucagcugguaauucu

 - 34

Get sequence
Evidence by similarity; MI0000368