Stem-loop sequence aga-mir-2-1

AccessionMI0001621 (change log)
Previous IDsaga-mir-2b
DescriptionAnopheles gambiae miR-2-1 stem-loop
Gene family MIPF0000049; mir-2
Literature search

2 open access papers mention aga-mir-2-1
(14 sentences)

Stem-loop
   gcau u    u   -      -         a    ugcacuu     
5'     g ccug cuc ucaaag uggcuguga augg       ucga 
       | |||| ||| |||||| ||||||||| ||||       ||| u
3'     c ggau gag aguuuc accgacacu uacu       agcc 
   ---g c    c   u      g         a    ---cuau     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 37757103-37757189 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-2-1
aga-mir-2-2chr2L: 37758699-37758796 [-]
aga-mir-2cchr2L: 37758085-37758193 [-]
aga-mir-13bchr2L: 37757564-37757657 [-]
aga-mir-2bchr2L: 37757412-37757490 [-]
aga-mir-2-1chr2L: 37757103-37757189 [-]
Database links

Mature sequence aga-miR-2

Accession MIMAT0009202
Sequence

58 - 

uaucacagccagcuuugaugagc

 - 80

Get sequence
Evidence by similarity; MI0000431

References

1
" Griffiths-Jones S Unpublished (2009).