Stem-loop sequence aga-mir-2-2

AccessionMI0001622 (change log)
Previous IDsaga-mir-2c
DescriptionAnopheles gambiae miR-2-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

2 open access papers mention aga-mir-2-2
(14 sentences)

Stem-loop
   uau      --cc        -        c        u     uu   u 
5'    ugggug    augcauug ucaucaaa uugguugu guagc  gcu u
      ||||||    |||||||| |||||||| |||||||| |||||  ||| g
3'    auccau    ugcguaac aguaguuu gaccgaca uaucg  uga a
   ---      ucac        g        c        c     -u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 37758699-37758796 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-2-2
aga-mir-2-2chr2L: 37758699-37758796 [-]
aga-mir-2cchr2L: 37758085-37758193 [-]
aga-mir-13bchr2L: 37757564-37757657 [-]
aga-mir-2bchr2L: 37757412-37757490 [-]
aga-mir-2-1chr2L: 37757103-37757189 [-]
Database links

Mature sequence aga-miR-2

Accession MIMAT0009202
Sequence

59 - 

uaucacagccagcuuugaugagc

 - 81

Get sequence
Evidence by similarity; MI0000431

References

1
" Griffiths-Jones S Unpublished (2009).