Stem-loop sequence aga-mir-307

AccessionMI0001624 (change log)
DescriptionAnopheles gambiae miR-307 stem-loop
Gene family MIPF0000293; mir-67
Literature search

1 open access papers mention aga-mir-307
(1 sentences)

Stem-loop
   ----uggac   u  u u  a  a         ccu  g       c     
5'          uca uc c cg uc cucacucaa   gg ugugaug uuuu 
            ||| || | || || |||||||||   || ||||||| ||| u
3'          agu ag g gc ag gagugaguu   cc acacuac aagu 
   accaaaauc   u  - c  c  c         ccu  a       u     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3L: 34537912-34538009 [+]
intergenic
Database links

Mature sequence aga-miR-307

Accession MIMAT0001519
Sequence

56 - 

ucacaaccuccuugagugag

 - 75

Get sequence
Evidence by similarity; MI0000418