Stem-loop sequence aga-mir-7

AccessionMI0001628 (change log)
DescriptionAnopheles gambiae miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

2 open access papers mention aga-mir-7
(4 sentences)

Stem-loop
         aca     u       u  u     u      u gcuu 
5' ggcaaa   uugua ggaagac ag gauuu guuguu g    a
   ||||||   ||||| ||||||| || ||||| |||||| |     
3' ccguuu   aacau cuuucug uc cuaaa uaacaa c    u
         -ga     -       c  u     -      u auag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 8302899-8302985 [-]
intergenic
Database links

Mature sequence aga-miR-7

Accession MIMAT0001523
Sequence

15 - 

uggaagacuagugauuuuguugu

 - 37

Get sequence
Evidence by similarity; MI0000127