Stem-loop sequence aga-mir-79

AccessionMI0001629 (change log)
DescriptionAnopheles gambiae miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention aga-mir-79
(3 sentences)

Stem-loop
   gug   -u      cgc       cgc       g     --   aau 
5'    ccc  uuuguc   gcuuugg   uuuagcu uauga  uag   u
      |||  ||||||   |||||||   ||||||| |||||  |||    
3'    ggg  aagcag   cgaaacc   agaucga auacu  auc   u
   -ca   uu      aua       auu       a     uu   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 5888298-5888391 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-79
aga-mir-9cchr3R: 5891167-5891256 [-]
aga-mir-306chr3R: 5888600-5888675 [-]
aga-mir-79chr3R: 5888298-5888391 [-]
aga-mir-9bchr3R: 5887786-5887878 [-]
Database links

Mature sequence aga-miR-79

Accession MIMAT0001524
Sequence

59 - 

uaaagcuagauuaccaaagcau

 - 80

Get sequence
Evidence by similarity; MI0000374