Stem-loop sequence aga-mir-79

Accession MI0001629
Description Anopheles gambiae miR-79 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gug   -u      cgc       cgc       g     --   aau 
   ccc  uuuguc   gcuuugg   uuuagcu uauga  uag   u
   |||  ||||||   |||||||   ||||||| |||||  |||    
   ggg  aagcag   cgaaacc   agaucga auacu  auc   u
-ca   uu      aua       auu       a     uu   aag 
Get sequence
Genome context
Coordinates (AgamP3) Overlapping transcripts
3R: 5888298-5888391 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-79
aga-mir-9c 3R: 5891167-5891256 [-]
aga-mir-306 3R: 5888600-5888675 [-]
aga-mir-79 3R: 5888298-5888391 [-]
aga-mir-9b 3R: 5887786-5887878 [-]

Mature sequence aga-miR-79

Accession MIMAT0001524
Sequence

59 - 

uaaagcuagauuaccaaagcau

 - 80

Get sequence
Evidence by similarity; MI0000374