Stem-loop sequence aga-mir-9a

AccessionMI0001631 (change log)
DescriptionAnopheles gambiae miR-9a stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention aga-mir-9a
(7 sentences)

Stem-loop
         -   cu       uau      g     g   au 
5' gucaau guu  cuuuggu   cuagcu uauga ugu  u
   |||||| |||  |||||||   |||||| ||||| |||  u
3' caguua uaa  gaagcca   gaucga auacu gca  u
         a   uu       uac      a     -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 15089290-15089370 [-]
intergenic
Database links

Mature sequence aga-miR-9a

Accession MIMAT0001526
Sequence

11 - 

ucuuugguuaucuagcuguauga

 - 33

Get sequence
Evidence by similarity; MI0000129