Stem-loop sequence aga-mir-9b

AccessionMI0001634 (change log)
DescriptionAnopheles gambiae miR-9b stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention aga-mir-9b
(8 sentences)

Stem-loop
      -   u       ac         uuu          u aaugc 
5' ugc cac uauuggg  uuuggugau   agcuguaugu g     a
   ||| ||| |||||||  |||||||||   |||||||||| |     u
3' aug gug guaaucc  aaaccacua   ucgauauaca c     u
      u   u       aa         -uu          c aaucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 5887786-5887878 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-9b
aga-mir-9cchr3R: 5891167-5891256 [-]
aga-mir-306chr3R: 5888600-5888675 [-]
aga-mir-79chr3R: 5888298-5888391 [-]
aga-mir-9bchr3R: 5887786-5887878 [-]
Database links

Mature sequence aga-miR-9b

Accession MIMAT0001529
Sequence

15 - 

acuuuggugauuuuagcuguaug

 - 37

Get sequence
Evidence by similarity; MI0000415