Stem-loop sequence aga-mir-9c

AccessionMI0001635 (change log)
DescriptionAnopheles gambiae miR-9c stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention aga-mir-9c
(4 sentences)

Stem-loop
   u      c  u            cu    g    -      uuu 
5'  uuccgg ug aucuuugguauu  agcu uaga auguug   u
    |||||| || ||||||||||||  |||| |||| ||||||   c
3'  aggguc ac uggagaccauga  ucga aucu uauaau   a
   a      a  c            uu    a    c      guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 5891167-5891256 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-9c
aga-mir-9cchr3R: 5891167-5891256 [-]
aga-mir-306chr3R: 5888600-5888675 [-]
aga-mir-79chr3R: 5888298-5888391 [-]
aga-mir-9bchr3R: 5887786-5887878 [-]
Database links

Mature sequence aga-miR-9c

Accession MIMAT0001530
Sequence

13 - 

ucuuugguauucuagcuguaga

 - 34

Get sequence
Evidence by similarity; MI0000413