Stem-loop sequence hsa-mir-448

AccessionMI0001637 (change log)
Symbol HGNC:MIR448
DescriptionHomo sapiens miR-448 stem-loop
Gene family MIPF0000149; mir-448
Literature search

36 open access papers mention hsa-mir-448
(235 sentences)

Stem-loop 
   -----------  c       u a            g   u     ga au    auu  au 
5'            gc gggaggu g acauccugcaua ugc gccag  a  cccu   uc  a
              || ||||||| | |||||||||||| ||| |||||  |  ||||   ||   
3'            cg cccucua c uguaggauguau acg ugguc  u  gggg   ag  u
   acugcuucacc  a       c c            -   u     gg cg    ---  aa
Get sequence
Deep sequencing
141 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MI0000035).

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 114823454-114823564 [+]
sense
OTTHUMT00000057977 ; PLS3-002; intron 1
OTTHUMT00000057976 ; PLS3-001; intron 1
OTTHUMT00000356068 ; PLS3-005; intron 1
ENST00000489283 ; PLS3-002; intron 1
ENST00000355899 ; PLS3-001; intron 1
ENST00000289290 ; PLS3-005; intron 1
ENST00000537301 ; PLS3-202; intron 1
Database links

Mature sequence hsa-miR-448

Accession MIMAT0001532
Sequence

71 -  

uugcauauguaggaugucccau

 - 92

Get sequence
Deep sequencing89 reads, 23 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).