![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-448 |
|||||
Accession | MI0001637 (change log) | ||||
Symbol | HGNC:MIR448 | ||||
Description | Homo sapiens miR-448 stem-loop | ||||
Gene family | MIPF0000149; mir-448 | ||||
Literature search |
![]()
36 open access papers mention hsa-mir-448 | ||||
Stem-loop |
----------- c u a g u ga au auu au 5' gc gggaggu g acauccugcaua ugc gccag a cccu uc a || ||||||| | |||||||||||| ||| ||||| | |||| || 3' cg cccucua c uguaggauguau acg ugguc u gggg ag u acugcuucacc a c c - u gg cg --- aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MI0000035). |
||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-448 |
|
Accession | MIMAT0001532 |
Sequence |
71 - uugcauauguaggaugucccau - 92 |
Deep sequencing | 89 reads, 23 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|