Stem-loop sequence rno-mir-448

AccessionMI0001639 (change log)
DescriptionRattus norvegicus miR-448 stem-loop
Gene family MIPF0000149; mir-448
Literature search

3 open access papers mention rno-mir-448
(69 sentences)

Stem-loop
   -----------a g       u a            g   u     ga au    a   ca 
5'             c gggaggu g acauccugcaua ugc gccag  a  cccu cuu  u
               | ||||||| | |||||||||||| ||| |||||  |  |||| |||   
3'             g cccucua c uguaggauguau acg ugguc  u  gggg gaa  a
   acugcuucaccc g       c c            -   u     gg cg    a   uc 
Get sequence
Deep sequencing
28813 reads, 22.6 reads per million, 137 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MI0000035).

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 118277684-118277795 [+]
sense
ENSRNOT00000065293 ; Htr2c-201; intron 5
Database links

Mature sequence rno-miR-448-5p

Accession MIMAT0017177
Previous IDsrno-miR-448*
Sequence

13 - 

aacauccugcauagugcugcca

 - 34

Get sequence
Deep sequencing1762 reads, 89 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-448-3p

Accession MIMAT0001534
Previous IDsrno-miR-448
Sequence

72 - 

uugcauauguaggauguccca

 - 92

Get sequence
Deep sequencing27044 reads, 129 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).