Stem-loop sequence cfa-mir-448

AccessionMI0001640 (change log)
DescriptionCanis familiaris miR-448 stem-loop
Gene family MIPF0000149; mir-448
Stem-loop 
   -----------  a       u a            g   u     ga au    auuuu 
5'            gc gggaggu g acauccugcaua ugc gccag  a  cccu     a
              || ||||||| | |||||||||||| ||| |||||  |  ||||      
3'            cg cccucua c uguaggauguau acg ugguc  u  gggg     u
   gcuacuucacc  c       c c            -   u     gg cg    aauca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MI0000035).

Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 87558063-87558172 [+]
sense
ENSCAFT00000047976 ; HTR2C-201; intron 4
Database links

Mature sequence cfa-miR-448

Accession MIMAT0001535
Sequence

70 -  

uugcauauguaggaugucccau

 - 91

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).