![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-429 |
||||||||
Accession | MI0001641 (change log) | |||||||
Symbol | HGNC:MIR429 | |||||||
Description | Homo sapiens miR-429 stem-loop | |||||||
Gene family | MIPF0000019; mir-8 | |||||||
Literature search |
![]()
194 open access papers mention hsa-mir-429 | |||||||
Stem-loop |
cgc c -uc ug cugg 5' cggc gaugggcg uuaccagaca guuagac c |||| |||||||| |||||||||| ||||||| 3' gucg cuaccugc aauggucugu uaaucug c --c c caa ca ucuc |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244). |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-429 |
|
Accession | MIMAT0001536 |
Sequence |
51 - uaauacugucugguaaaaccgu - 72 |
Deep sequencing | 200286 reads, 134 experiments |
Evidence | experimental; cloned [1-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|
2 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|