Stem-loop sequence hsa-mir-429

Accession

MI0001641 (change log)

Symbol

HGNC:MIR429

Description

Homo sapiens miR-429 stem-loop

Gene family

MIPF0000019; mir-8

Literature search

194 open access papers mention hsa-mir-429
(660 sentences)

Stem-loop

   cgc    c        -uc          ug       cugg 
5'    cggc gaugggcg   uuaccagaca  guuagac    c
      |||| ||||||||   ||||||||||  |||||||     
3'    gucg cuaccugc   aauggucugu  uaaucug    c
   --c    c        caa          ca       ucuc 

Deep sequencing

200373 reads, 382 reads per million, 133 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244).

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 1169005-1169087 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000005071 ; B3GALT6-001; exon 1

  ENST00000379198 ; B3GALT6-001; exon 1

Clustered miRNAs

< 10kb from hsa-mir-429

• hsa-mir-200b: chr1: 1167104-1167198 [+]
• hsa-mir-200a: chr1: 1167863-1167952 [+]
• hsa-mir-429: chr1: 1169005-1169087 [+]

Database links

• EntrezGene:MIR429
• HGNC:MIR429
• RNAcentral:URS000075B715_9606
• miRBase Tracker:MI0001641

Mature sequence hsa-miR-429

• Accession: MIMAT0001536
• Sequence: 51 - uaauacugucugguaaaaccgu - 72
• Deep sequencing: 200286 reads, 134 experiments
• Evidence: experimental; cloned [1-4]
• Database links:
  • RNAcentral:URS000055BBE5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-429
  • TargetScanVert:hsa-miR-429
  • miRDB:hsa-miR-429
  • microrna.org:hsa-miR-429

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).