Stem-loop sequence hsa-mir-449a

Accession MI0001648
Previous IDs hsa-mir-449
Symbol HGNC:MIR449A
Description Homo sapiens miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
-c      ug     c       -    u          ugaa   g 
  ugugug  augag uggcagu guau guuagcuggu    uau u
  ||||||  ||||| ||||||| |||| ||||||||||    |||  
  auauac  uauuc gucguca cgua caaucggcua    gua g
ac      gu     u       a    -          --cg   a 
Get sequence
Deep sequencing
22 reads, 6 experiments
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MI0000025 ).

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 54466360-54466450 [-]
sense
OTTHUMT00000369716 ; CDC20B-005; intron 1
OTTHUMT00000369716 ; CDC20B-005; intron 1
OTTHUMT00000369716 ; CDC20B-005; intron 1
OTTHUMT00000253908 ; CDC20B-001; intron 2
OTTHUMT00000369715 ; CDC20B-004; intron 2
OTTHUMT00000369714 ; CDC20B-003; intron 2
OTTHUMT00000369713 ; CDC20B-002; intron 2
OTTHUMT00000253908 ; CDC20B-001; intron 2
OTTHUMT00000369715 ; CDC20B-004; intron 2
OTTHUMT00000369714 ; CDC20B-003; intron 2
OTTHUMT00000369713 ; CDC20B-002; intron 2
OTTHUMT00000253908 ; CDC20B-001; intron 2
OTTHUMT00000369715 ; CDC20B-004; intron 2
OTTHUMT00000369714 ; CDC20B-003; intron 2
OTTHUMT00000369713 ; CDC20B-002; intron 2
ENST00000507931 ; CDC20B-005; intron 1
ENST00000331730 ; CDC20B-201; intron 1
ENST00000507931 ; CDC20B-005; intron 1
ENST00000331730 ; CDC20B-201; intron 1
ENST00000507931 ; CDC20B-005; intron 1
ENST00000331730 ; CDC20B-201; intron 1
ENST00000296733 ; CDC20B-001; intron 2
ENST00000381375 ; CDC20B-004; intron 2
ENST00000322374 ; CDC20B-003; intron 2
ENST00000513180 ; CDC20B-002; intron 2
ENST00000334206 ; CDC20B-202; intron 2
ENST00000296733 ; CDC20B-001; intron 2
ENST00000381375 ; CDC20B-004; intron 2
ENST00000322374 ; CDC20B-003; intron 2
ENST00000513180 ; CDC20B-002; intron 2
ENST00000334206 ; CDC20B-202; intron 2
ENST00000296733 ; CDC20B-001; intron 2
ENST00000381375 ; CDC20B-004; intron 2
ENST00000322374 ; CDC20B-003; intron 2
ENST00000513180 ; CDC20B-002; intron 2
ENST00000334206 ; CDC20B-202; intron 2
Clustered miRNAs
< 10kb from hsa-mir-449a
hsa-mir-449c chr5: 54468090-54468181 [-]
hsa-mir-449b chr5: 54466474-54466570 [-]
hsa-mir-449a chr5: 54466360-54466450 [-]
Database links

Mature sequence hsa-miR-449a

Accession MIMAT0001541
Previous IDs hsa-miR-449
Sequence

16 - 

uggcaguguauuguuagcuggu

 - 37

Get sequence
Deep sequencing 22 reads, 6 experiments
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).