Stem-loop sequence dre-mir-429a

AccessionMI0001720 (change log)
Previous IDsdre-mir-429
DescriptionDanio rerio miR-429 stem-loop
Gene family MIPF0000019; mir-8
Literature search

11 open access papers mention dre-mir-429a
(52 sentences)

Stem-loop
   cu   u        u -          ug      ug   u 
5'   ugu gauggacg c uuaccagaca  guuaga  uaa a
     ||| |||||||| | ||||||||||  ||||||  |||  
3'   aca cuaccugc g aauggucugu  uaaucu  guu a
   gu   -        c u          ca      gu   c 
Get sequence
Deep sequencing
33344 reads, 1.49e+03 reads per million, 11 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 24073815-24073896 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-429a
dre-mir-200bchr23: 24072029-24072110 [+]
dre-mir-200achr23: 24072160-24072245 [+]
dre-mir-429achr23: 24073815-24073896 [+]
dre-mir-7149chr23: 24074083-24074155 [+]
Database links

Mature sequence dre-miR-429a

Accession MIMAT0001624
Previous IDsdre-miR-429
Sequence

51 - 

uaauacugucugguaaugccgu

 - 72

Get sequence
Deep sequencing33331 reads, 11 experiments
Evidence by similarity; MI0001641
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).