![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-329-1 |
||||||||||||||||||||||||||||
Accession | MI0001725 (change log) | |||||||||||||||||||||||||||
Symbol | HGNC:MIR329-1 | |||||||||||||||||||||||||||
Description | Homo sapiens miR-329-1 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000110; mir-329 | |||||||||||||||||||||||||||
Literature search |
![]()
28 open access papers mention hsa-mir-329-1 | |||||||||||||||||||||||||||
Stem-loop |
cu uu ug uuc u aa 5' gguac gaagagagguu c ggu uguuuc uu u ||||| ||||||||||| | ||| |||||| || 3' cuaug cuuuucuccaa g cca acaaag ag g ac uu gu --c c ga |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-329-5p |
|
Accession | MIMAT0026555 |
Sequence |
13 - gagguuuucuggguuucuguuuc - 35 |
Deep sequencing | 1096 reads, 36 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-329-3p |
|
Accession | MIMAT0001629 |
Sequence |
50 - aacacaccugguuaaccucuuu - 71 |
Deep sequencing | 9112 reads, 112 experiments |
Evidence | experimental; cloned [1,3-4], array-cloned [2], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
3 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|