miRBase entry: hsa-mir-329-2

Stem-loop hsa-mir-329-2


Accession
MI0001726
Symbol
HGNC: MIR329-2
Description
Homo sapiens hsa-mir-329-2 precursor miRNA
Gene family
MIPF0000110; mir-329

Literature search
28 open access papers mention hsa-mir-329-2
(177 sentences)

Sequence

2392 reads, 55 reads per million, 85 experiments
gugguaccugaagaGAGGUUUUCUGGGUUUCUGUUUCuuuauugaggacgaAACACACCUGGUUAACCUCUUUuccaguaucaa
.((((((..(((((((((((..((((((...((((((.((......)).)))))).))))))..)))))))))))..)))))).

Structure
g      cu           UU      UUC      u  au 
 ugguac  gaagaGAGGUU  CUGGGU   UGUUUC uu  u
 ||||||  |||||||||||  ||||||   |||||| ||   
 acuaug  cuUUUCUCCAA  GGUCCA   ACAAag ag  g
a      ac           UU      --C      c  ga 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101027100-101027183 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from hsa-mir-329-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-329-3p

Accession MIMAT0001629
Description Homo sapiens hsa-miR-329-3p mature miRNA
Sequence 52 - AACACACCUGGUUAACCUCUUU - 73
Evidence experimental
cloned [1,3-4], array-cloned [2], Illumina [5]
Database links
Predicted targets

Mature hsa-miR-329-5p

Accession MIMAT0026555
Description Homo sapiens hsa-miR-329-5p mature miRNA
Sequence 15 - GAGGUUUUCUGGGUUUCUGUUUC - 37
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  5. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45