Stem-loop sequence dre-mir-451

AccessionMI0001732
DescriptionDanio rerio miR-451 stem-loop
Gene family MIPF0000148; mir-451
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
             a    g            a 
5' agaggcggcg aacc uuaccauuacug g
   |||||||||| |||| ||||||||||||  
3' uuuccgucgu uugg aaugguaaugau u
             c    g            u 
Get sequence
Deep sequencing
7950 reads, 2.53e+03 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 43890553-43890612 [-]
sense
OTTDART00000022480 ; si:ch211-207c6.2-001; exon 2
ENSDART00000137692 ; si:ch211-207c6.2-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-451
dre-mir-1445: 43890656-43890744 [-]
dre-mir-4515: 43890553-43890612 [-]
Database links

Mature sequence dre-miR-451

Accession MIMAT0001634
Sequence

11 - 

aaaccguuaccauuacugaguu

 - 32

Get sequence
Deep sequencing7316 reads, 5 experiments
Evidence experimental; cloned [2]
Validated targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).