Stem-loop sequence dre-mir-451

AccessionMI0001732 (change log)
DescriptionDanio rerio miR-451 stem-loop
Gene family MIPF0000148; mir-451
Literature search

3 open access papers mention dre-mir-451
(13 sentences)

Stem-loop
             a    g            a 
5' agaggcggcg aacc uuaccauuacug g
   |||||||||| |||| ||||||||||||  
3' uuuccgucgu uugg aaugguaaugau u
             c    g            u 
Get sequence
Deep sequencing
8104 reads, 991 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 42271971-42272030 [-]
sense
OTTDART00000022480 ; si:ch211-207c6.2-001; exon 2
ENSDART00000137692 ; si:ch211-207c6.2-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-451
dre-mir-144chr5: 42272074-42272162 [-]
dre-mir-451chr5: 42271971-42272030 [-]
Database links

Mature sequence dre-miR-451

Accession MIMAT0001634
Sequence

11 - 

aaaccguuaccauuacugaguu

 - 32

Get sequence
Deep sequencing8087 reads, 11 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).