Stem-loop sequence mtr-MIR162

AccessionMI0001738 (change log)
DescriptionMedicago truncatula miR162 stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

3 open access papers mention mtr-MIR162
(21 sentences)

Stem-loop
   agau    -u     uc u a          c    c       u    c  aau       guc 
5'     gagg  gaagu  g c cuggaugcag gguu aucgauc guuc ug   uuuguuu   u
       ||||  |||||  | | |||||||||| |||| ||||||| |||| ||   |||||||    
3'     cucc  uuuca  c g gaccuacguc ccaa uagcugg uaag ac   aaacaaa   c
   ---u    cc     cu - c          u    a       c    u  ---       aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 38145140-38145263 [+]
intergenic
Database links

Mature sequence mtr-miR162

Accession MIMAT0001640
Sequence

87 - 

ucgauaaaccucugcauccag

 - 107

Get sequence
Evidence experimental; Northern [3]

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).